PepperProof of Concept
Scoville Splice · ScovilleSplice.farm
SS-0088 — Kill Switch
Product Specification
- Product ID
- SS-0088
- Product Name
- Kill Switch
- Target Organism
- Pepper (C. chinense)
- Engineering Tier
- Pepper
- Series
- Heat Ladder
- Target SHU
- 4,000,000
- Pun1/CS Variant
- Triple
- Gene Count
- 8
- Construct Length
- 13,345 bp
- Construct Type
- T-DNA binary vector
- Selection Marker
- nptII (kanamycin resistance)
- Promoter System
- 2A11
- Codon Optimization
- pepper
- Capsaicinoid Profile
- extreme multi
- Burn Character
- Heat Ladder: Kill Switch
Gene Cassette Map
LB — [nptII] — [pAMT] — [Pun1/CS Triple] — [BCAT] — [KAS] — [FAR] — [PAL] — [C4H] — [4CL] — RB
| Gene | Function | Role |
|---|---|---|
| pAMT | Putative aminotransferase | Vanillylamine biosynthesis |
| Pun1/CS (Triple) | Capsaicin synthase | Acyl-vanillylamine condensation |
| BCAT | Pathway enzyme | Capsaicinoid pathway |
| KAS | Pathway enzyme | Capsaicinoid pathway |
| FAR | Pathway enzyme | Capsaicinoid pathway |
| PAL | Pathway enzyme | Capsaicinoid pathway |
| C4H | Pathway enzyme | Capsaicinoid pathway |
| 4CL | Pathway enzyme | Capsaicinoid pathway |
Flux Balance Analysis
- Predicted Capsaicin
- 200.0 μmol/g
- Predicted DHC
- 30.0 μmol/g
- Total Flux
- 1.9518 μmol/h
- Vanillylamine Branch
- 0.649
- Acyl Branch
- 0.424
- Condensation Efficiency
- 0.428
- Growth Impact
- 0.513 (fraction of WT)
- Feasibility
- EXPLORATORY
CRISPR Guide RNAs (POX Knockout)
| Target | Spacer (20-mer) | PAM | GC% | Efficiency |
|---|---|---|---|---|
| CaPOX1 | CGGAAAAGCACCGCCATTGG | NGG | 60.0% | 0.812 |
| CaPOX2 | AGTGGTATGCGTCACCGCAC | NGG | 60.0% | 0.793 |
| CaPOX3 | TGCGCGTCATGACCTACTTT | NGG | 50.0% | 0.579 |
| CaPOX4 | CCATCGCCAGGGAGTCGTGG | NGG | 70.0% | 0.737 |
| CaPOX5 | ACGCGGTATCCGGTTAAGCA | NGG | 55.0% | 0.571 |
Transformation Protocol Summary
- Vector
- T-DNA binary vector in Agrobacterium tumefaciens GV3101
- Selection
- 50 mg/L kanamycin
- Confirmation
- PCR with construct-specific primers + HPLC capsaicinoid assay
- Expected Timeline
- 4-6 weeks (callus to T0 plant)